myc ddk  (OriGene)

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Top ten upregulated genes in PLC/PRF/5 Sor-R resistant cells.

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques:

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: In vitro validation of the role of IL7 and MAL2 in HCC-associated Sorafenib drug resistance. ( A ) IL7 and MAL2 were significantly overexpressed in Sorafenib-resistant mutant PLC/PRF/5 cell pool (Sor-R) compared to the wild-type (WT) parental cell line by qPCR. ****, p < 0.0001; Student unpaired t -test. ( B ) Graphical representation showing significantly more colony forming ability by Sorafenib-resistant mutant PLC/PRF/5 (PLC5 Sor-R) cells when compared with wild-type (WT) parental PLC/PRF/5 (PLC5) cells under different Sorafenib concentrations (4 and 8 µM). ****, p < 0.0001; *, p < 0.05; two-way ANOVA test. ( C ) Overexpression of IL7 and/or MAL2 were confirmed in transfected PLC5 cells by qPCR compared with GFP control transfected cells. ****, p < 0.0001; Student unpaired t -test. Representative clonogenic survival assay images of PLC5 cells overexpressing IL7 and/or MAL2 under different Sorafenib concentrations. ( D ) Co-expression of IL7 and MAL2 in PLC5 cells treated with 10 µM Sorafenib induced greater anti-apoptotic effect compared with control GFP -overexpressing cells. Flow cytometry profiles represented intensity of Annexin-V-APC staining in X -axis and PI in Y -axis. ( E ) Graphical quantification of the apoptosis assay. ****, p < 0.0001; ***, p < 0.001; **, p < 0.01; two-way ANOVA test.

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: In Vitro, Mutagenesis, Over Expression, Transfection, Control, Clonogenic Cell Survival Assay, Expressing, Flow Cytometry, Staining, Apoptosis Assay

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Activation of JAK/STAT and PI3K/AKT signaling pathways by IL7 and MAL2 in HCC-associated Sorafenib resistance. ( A ) Representative Western blot and relative protein level analyses confirming STAT3 activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. ( B ) Representative Western blot and relative protein level analyses confirming PI3K/AKT activation in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells. *, p < 0.05; **, p < 0.01; two-way ANOVA test. ( C ) CDKN1A expression was significantly induced in IL7 and/or MAL2 overexpressing PLC/PRF/5 cells under Sorafenib treatment. **, p < 0.01; ***, p < 0.001; Student unpaired t -test. ( D ) Representative Western blot and relative protein level analyses showing reduced phosphorylated JNK (p-JNK) levels in IL7 and MAL2 overexpressing PLC/PRF/5 cells compared with GFP control cells under Sorafenib treatment in a dose dependent manner. ( E ) Summary diagram showing MAL2, a transmembrane protein, contributes to intracellular trafficking and secretion of IL7 to the plasma membrane. The binding of IL7 to cytokine receptors result in the activation of important downstream survival signaling pathways that contributes to Sorafenib resistance. The uncropped bolts are shown in .

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: Activation Assay, Western Blot, Control, Expressing, Membrane, Binding Assay

Journal: Cancers

Article Title: Sorafenib Resistance Contributed by IL7 and MAL2 in Hepatocellular Carcinoma Can Be Overcome by Autophagy-Inducing Stapled Peptides

doi: 10.3390/cancers15215280

Figure Lengend Snippet: Autophagy-inducing stapled peptides exerted a synergistic anti-proliferative effect with Sorafenib in resistant HCC cells that co-overexpress both IL7 and MAL2. ( A ) Autophagy markers p62 and LC3-II were measured by Western blot in IL7 and MAL2-overexpressing PLC/PRF/5 cells compared with GFP control PLC/PRF/5 cells after treatment with or without the autophagy inducer rapamycin (500 nM, 3 h). ( B ) Statistic analysis of LC3-II and p62 level change of ( A ) after normalization to the level of β-Actin. ( C ) The two autophagy markers were assessed using Western blot in GFP control PLC/PRF/5 cells after treatment with Tat-SP9 (0, 10, 20 μM for 12 h) and Tat-SP4 (0, 10, 20 μM for 3 h) with or without 1 μM CQ. ( D ) Statistic analysis of LC3-II and p62 level change of ( C ) after normalization to the level of β-Actin. ( E ) Similar Western blots as ( C ), but cells are IL7 and MAL2-overexpressing PLC/PRF/5 cells. ( F ) Statistic analysis of LC3-II and p62 level change of ( E ) after normalization to the level of β-Actin. Bar represents mean ± SEM of three replicates. ( G ) Cell viability was assessed in IL7 and MAL2 -overexpressing PLC/PRF/5 cells and GFP control PLC/PRF/5 cells after treatment with different concentrations of Tat-SP9 and Tat-SP4. The estimated IC 50 value for Tat-SP9 was 12.63 μM in GFP control PLC/PRF/5 cells and 12.58 μM in Sorafenib-resistant cells, while the estimated IC 50 value for Tat-SP4 was 69.71 μM in control cells and 69.89 μM in resistant cells. ( H ) Clonogenic survival assay images were taken for both GFP control PLC/PRF/5 GFP cells and IL7 and MAL2-overexpressing PLC/PRF/5 cells under different concentrations of Tat-SP9 (10, 15, 20 μM). Bars represent mean ± SEM (n = 3). ( I ) Representative clonogenic survival assay images of GFP control PLC/PRF/5 cells and Sorafenib-resistant PLC/PRF/5 cells after treatment with Tat-SP9 (10 μM) or Sorafenib (2 or 4 μM), alone or combined. Bars represent mean ± SEM of three replicates. NS means no significant difference *, p < 0.05; **, p < 0.01; ***, p < 0.001,****, p < 0.0001 two-way ANOVA test. The uncropped bolts are shown in .

Article Snippet: The Lenti ORF clone of human MAL2 , Myc-DDK-tagged (OriGene Technologies; RC203862L1) was also used as cDNA template of MAL2 for high fidelity PCR using primer pairs Kpn I-Kozak- MAL2 forward CAGGGTACCGCCACCATGTCGGCCGGCGGAGCGTC (5′ to 3′) and Eco RV- MAL2 reverse CGTACGATATCTTACGGTCG CCATCTTCGTA (5′ to 3′), then cloned into a PB transposon expression vector using a similar method for generating pPB/SB- IL7 -GFP-Puro.

Techniques: Western Blot, Control, Clonogenic Cell Survival Assay

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Immunofluorescence staining for HER2 and cholera toxin B in MCF10A and SKBR3 cells. Scale bars represent 10 μm. (B) Lipid raft areas on the cell surface, with quantification in the bar graph on the right. (C) Flotillin1 (FLOT1), MAL, and MAL2 mRNA expression in different breast cancer cell lines as assessed by quantitative PCR (n = 3). (D) RNA-seq analysis of FLOT1 and MAL2 expression in normal breast tissue (n = 112) and HER2-positive breast tumors (n = 160) represented in The Cancer Genome Atlas database. (E) Uniform Manifold Approximation and Projection (UMAP) plots of breast cancer single-cell RNA-seq data (GEO: GSE75688, left) and co-expression pattern of HER2, FLOT1, MAL, and MAL2 in cells from cluster 2. (F) Distribution of MAL, FLOT1, MAL2, and HER2 expression level for each cell in cluster 2. (G) MAL2 ATAC-seq peak clusters in SKBR3, MCF10A, MCF7, and MDA-MB-231 cell lines. In the bar graphs, the bars represent the mean ± SEM. **p <0.01, ***p <0.001, ****p <0.0001. These results are representative of three independent experiments.

Article Snippet: Constructs encoding flag-flotillin1 (RC200231) and flag-MAL2 (RC203862) are commercially available from OriGene (Rockville, MD).

Techniques: Immunofluorescence, Staining, Expressing, Real-time Polymerase Chain Reaction, RNA Sequencing Assay

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Immunofluorescence staining for HER2 and MAL2 (top row) and MAL2 and cholera toxin B (lipid rafts) (bottom row) in SKBR3 cells. (B) Immunofluorescence staining for FLAG-tagged MAL2 or endogenous MAL2 with HER2 and actin in control and MβCD (5 mM)-treated SKBR3 cells. Scale bars represent 10 μm. (C) Proximity ligation assay (PLA) experiment for HER2 and MAL2 in control and MβCD (5 mM)-treated SKBR3 cells also stained for actin (phalloidin). Scale bars represent 10 μm. (D) MAL2 mRNA expression in control and MAL2 knockdown SKBR3 and BT474 cells as assessed by quantitative RT-PCR (n = 3). (E) Western blot analysis of HER2, phospho-HER2, EGFR, and phospho-EGFR in control and MAL2 knockdown SKBR3 and BT474 cells. (F) BrdU incorporation in MAL2KD cells relative to control SKBR3 and BT474 cells. (G) PLA experiment for HER2 and MAL2 in control and MAL2LD SKBR3 cells. Scale bars represent 10 μm. (H) Transmission electron microscopy images in control and MAL2 knockdown SKBR3 cells. (I) Immunofluorescence staining HER2 and cholera toxin B in control (top), MAL2KD-treated (middle), and MβCD-treated (5 mM) SKBR3 cells. Scale bars represent 10 μm. (J) Immunofluorescence staining for FLAG-tagged FLOT1, HER2, and phalloidin in control, MAL2KD-treated, and MβCD (5 mM)-treated SKBR3 cells. Scale bars represent 10 μm. (K) Immunofluorescence staining for HER2 and EGFR in control and MAL2KD SKBR3 cells. Scale bars represent 10 μm. (L) PLA experiment for HER2 and EGFR in control and MAL2KD SKBR3 cells also stained for actin (phalloidin). Scale bars represent 10μm. (M) Quantitation of PLA experiment by measuring fluorescent intensity of amplified PLA reactions and phalloidin. Bar graphs represent the mean ± SEM. **p <0.01, ***p <0.001, ****p <0.0001. These results are representative of three independent experiments.

Article Snippet: Constructs encoding flag-flotillin1 (RC200231) and flag-MAL2 (RC203862) are commercially available from OriGene (Rockville, MD).

Techniques: Immunofluorescence, Staining, Proximity Ligation Assay, Expressing, Quantitative RT-PCR, Western Blot, BrdU Incorporation Assay, Transmission Assay, Electron Microscopy, Quantitation Assay, Amplification

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) SIM imaging of fluorescent staining for HER2, Ezrin, and phalloidin in control SKBR3 cells. Images represent different combinations of staining as noted on the figures. Bottom left: a 3D reconstruction for all three molecules. Scale bars represent 10 μm. (B) SIM imaging of fluorescent staining for HER2, HA-tagged NHERF1, and phalloidin in control SKBR3 cells. Bottom left: a 3D reconstruction for all three molecules. Scale bars represent 10 μm. (C) SIM imaging of fluorescent staining for HER2, Ezrin, and phalloidin in MAL2 knockdown SKBR3 cells. Scale bars represent 10 μm. (D) SIM imaging of fluorescent staining for HER2, HA-tagged NHERF1, and phalloidin in MAL2 knockdown SKBR3 cells. Scale bars represent 10 μm. (E) PLA for HER2 with Ezrin (left panels) or NHERF1 (right panels) in control (top row), MAL2 knockdown-treated (middle row) and MβCD-treated (bottom row) SKBR3 cells. Columns labeled “Middle” represent an optical section through the mid-portion of the cells. Columns labeled “Top“ represent an optical section taken near the apical surface of the cell. Columns labeled “w/Phalloidin” represent co-registration of the PLA signal and immunofluorescence for actin (phalloidin). Scale bars represent 10 μm (for all images). (F) Percentage of cells with positive PLA reactions located within membrane protrusions. (G) Quantitation of PLA fluorescent intensity within membrane protrusions. Bar graphs represent the mean ± SEM. ****p <0.0001. These results are representative of three independent experiments.

Article Snippet: Constructs encoding flag-flotillin1 (RC200231) and flag-MAL2 (RC203862) are commercially available from OriGene (Rockville, MD).

Techniques: Imaging, Staining, Labeling, Immunofluorescence, Quantitation Assay

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Co-immunofluorescence staining for Ezrin (top) or HER2 (bottom) with phalloidin in PH-PLCδ-GFP-expressing control SKBR3 cells. Scale bars represent 10 μm. (B) Immunofluorescence staining for Ezrin (top) or HER2 (bottom) with phalloidin in PH-PLCδ-GFP-expressing MAL2KD_SKBR3 cells. (C) Immunofluorescence staining for Ezrin (top) or HER2 (bottom) with phalloidin in PH-PLCδ-GFP-expressing SKBR3 cells treated with MβCD. (D) Immunofluorescence staining for Ezrin with phalloidin in PH-PLCδ-GFP-expressing SKBR3 cells treated with wortmannin (0, 5, and 10 μM). (E) Immunofluorescence staining for HER2 with phalloidin in PH-PLCδ-GFP-expressing SKBR3 cells treated with wortmannin (0, 5, and 10 μM). (F) PLA results for HER2 and Ezrin in control and wortmannin-treated SKBR3 cells. Scale bars represent 10 μm. (G) Western blot analysis of AKT and phospho-AKT in control and MAL2 knockdown SKBR3 cells (left) and in control and MβCD-treated SKBR3 cells (right). (H–J) SIM imaging showing HER2, pAKT, and phalloidin immunofluorescence in control (H), MAL2KD (I)-treated, and MβCD-treated (J) SKBR3 cells. Scale bars represent 10 μm. (K) Immunofluorescence staining for FOXO1 in control, MAL2KD-treated, and MβCD-treated SKBR3 cells. (L) XTT cell viability assay in control, MAL2KD-treated, and MβCD-treated SKBR3 and BT474 cells. Bar graphs represent the mean ± SEM. ****p <0.0001. These results are representative of three independent experiments.

Article Snippet: Constructs encoding flag-flotillin1 (RC200231) and flag-MAL2 (RC203862) are commercially available from OriGene (Rockville, MD).

Techniques: Immunofluorescence, Staining, Expressing, Western Blot, Imaging, Viability Assay

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Immunofluorescence staining for cholera toxin B (lipid rafts) in control and trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (B) Immunofluorescence staining for HER2 and MAL2 in control and trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (C) PLA for HER2 and MAL2 in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Scale bars represent 10 μm. (D–F) Quantitative results from immunoprecipitation coupled with data-independent acquisition mass spectrometry (DIA-MS) in control and trastuzumab-resistant SKBR3 cells. (D) The DIA-MS Intensity (log 2 ) of HER2 and MAL2 proteins from control and trastuzumab-resistant SKBR3 cells. (E) The DIA-MS Intensity (log 2 ) for all the peptide precursor signals of HER2 in control and resistant cells. (F) The DIA-MS peak groups visualized for quantifying HER2 (VLGSGAFGTVYK) and MAL2 (VTLPAGPDILR). Peaks above and below the middle line denote the MS2 and MS1 ion traces in DIA-MS. (G) MAL2, Ezrin, and NHERF1 mRNA expression in control and trastuzumab-resistant SKBR3 cells as assessed by quantitative RT-PCR (n = 3). (H) PLA for HER2 with Ezrin (left), NHERF1 (middle), and PMCA2 (right) in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Boxed portions are amplified at right with co-registration of PLA signal and immunofluorescence for actin (phalloidin). (I) Quantitation of PLA experiment for HER2 in combination with MAL2, Ezrin, NHERF1, or PMCA2 represented as the fluorescent intensity of amplified PLA signals associated with membrane protrusions. (J) Coimmunoprecipitation for HER2 and HSP90 in control and trastuzumab-resistant SKBR3 cells. (K) PLA for HER2 and HSP90 in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Scale bars represent 10 μm. (L) XTT cell viability assay in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 and BT474 cells. (M) Immunofluorescence staining for FOXO1 in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 cells. (N) Immunofluorescence staining for HER2 and pAKT in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (O) Diagram representing the structure of MAL2- and lipid raft-enriched membrane protrusions containing multi-protein HER2 signaling complexes. These results are representative of three independent experiments.

Article Snippet: Constructs encoding flag-flotillin1 (RC200231) and flag-MAL2 (RC203862) are commercially available from OriGene (Rockville, MD).

Techniques: Immunofluorescence, Staining, Immunoprecipitation, Mass Spectrometry, Expressing, Quantitative RT-PCR, Amplification, Quantitation Assay, Viability Assay

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Constructs encoding flag-flotillin1 (RC200231) and flag-MAL2 (RC203862) are commercially available from OriGene (Rockville, MD).

Techniques: Recombinant, Real-time Polymerase Chain Reaction, RNA Sequencing Assay, Sequencing, Microarray, Software, Imaging, Light Microscopy

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Immunofluorescence staining for HER2 and cholera toxin B in MCF10A and SKBR3 cells. Scale bars represent 10 μm. (B) Lipid raft areas on the cell surface, with quantification in the bar graph on the right. (C) Flotillin1 (FLOT1), MAL, and MAL2 mRNA expression in different breast cancer cell lines as assessed by quantitative PCR (n = 3). (D) RNA-seq analysis of FLOT1 and MAL2 expression in normal breast tissue (n = 112) and HER2-positive breast tumors (n = 160) represented in The Cancer Genome Atlas database. (E) Uniform Manifold Approximation and Projection (UMAP) plots of breast cancer single-cell RNA-seq data (GEO: GSE75688, left) and co-expression pattern of HER2, FLOT1, MAL, and MAL2 in cells from cluster 2. (F) Distribution of MAL, FLOT1, MAL2, and HER2 expression level for each cell in cluster 2. (G) MAL2 ATAC-seq peak clusters in SKBR3, MCF10A, MCF7, and MDA-MB-231 cell lines. In the bar graphs, the bars represent the mean ± SEM. **p <0.01, ***p <0.001, ****p <0.0001. These results are representative of three independent experiments.

Article Snippet: MAL2 (NM_052886) Human Tagged ORF Clone , Origene , Cat#RC203862.

Techniques: Immunofluorescence, Staining, Expressing, Real-time Polymerase Chain Reaction, RNA Sequencing

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Immunofluorescence staining for HER2 and MAL2 (top row) and MAL2 and cholera toxin B (lipid rafts) (bottom row) in SKBR3 cells. (B) Immunofluorescence staining for FLAG-tagged MAL2 or endogenous MAL2 with HER2 and actin in control and MβCD (5 mM)-treated SKBR3 cells. Scale bars represent 10 μm. (C) Proximity ligation assay (PLA) experiment for HER2 and MAL2 in control and MβCD (5 mM)-treated SKBR3 cells also stained for actin (phalloidin). Scale bars represent 10 μm. (D) MAL2 mRNA expression in control and MAL2 knockdown SKBR3 and BT474 cells as assessed by quantitative RT-PCR (n = 3). (E) Western blot analysis of HER2, phospho-HER2, EGFR, and phospho-EGFR in control and MAL2 knockdown SKBR3 and BT474 cells. (F) BrdU incorporation in MAL2KD cells relative to control SKBR3 and BT474 cells. (G) PLA experiment for HER2 and MAL2 in control and MAL2LD SKBR3 cells. Scale bars represent 10 μm. (H) Transmission electron microscopy images in control and MAL2 knockdown SKBR3 cells. (I) Immunofluorescence staining HER2 and cholera toxin B in control (top), MAL2KD-treated (middle), and MβCD-treated (5 mM) SKBR3 cells. Scale bars represent 10 μm. (J) Immunofluorescence staining for FLAG-tagged FLOT1, HER2, and phalloidin in control, MAL2KD-treated, and MβCD (5 mM)-treated SKBR3 cells. Scale bars represent 10 μm. (K) Immunofluorescence staining for HER2 and EGFR in control and MAL2KD SKBR3 cells. Scale bars represent 10 μm. (L) PLA experiment for HER2 and EGFR in control and MAL2KD SKBR3 cells also stained for actin (phalloidin). Scale bars represent 10μm. (M) Quantitation of PLA experiment by measuring fluorescent intensity of amplified PLA reactions and phalloidin. Bar graphs represent the mean ± SEM. **p <0.01, ***p <0.001, ****p <0.0001. These results are representative of three independent experiments.

Article Snippet: MAL2 (NM_052886) Human Tagged ORF Clone , Origene , Cat#RC203862.

Techniques: Immunofluorescence, Staining, Control, Proximity Ligation Assay, Expressing, Knockdown, Quantitative RT-PCR, Western Blot, BrdU Incorporation Assay, Transmission Assay, Electron Microscopy, Quantitation Assay, Amplification

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) SIM imaging of fluorescent staining for HER2, Ezrin, and phalloidin in control SKBR3 cells. Images represent different combinations of staining as noted on the figures. Bottom left: a 3D reconstruction for all three molecules. Scale bars represent 10 μm. (B) SIM imaging of fluorescent staining for HER2, HA-tagged NHERF1, and phalloidin in control SKBR3 cells. Bottom left: a 3D reconstruction for all three molecules. Scale bars represent 10 μm. (C) SIM imaging of fluorescent staining for HER2, Ezrin, and phalloidin in MAL2 knockdown SKBR3 cells. Scale bars represent 10 μm. (D) SIM imaging of fluorescent staining for HER2, HA-tagged NHERF1, and phalloidin in MAL2 knockdown SKBR3 cells. Scale bars represent 10 μm. (E) PLA for HER2 with Ezrin (left panels) or NHERF1 (right panels) in control (top row), MAL2 knockdown-treated (middle row) and MβCD-treated (bottom row) SKBR3 cells. Columns labeled “Middle” represent an optical section through the mid-portion of the cells. Columns labeled “Top“ represent an optical section taken near the apical surface of the cell. Columns labeled “w/Phalloidin” represent co-registration of the PLA signal and immunofluorescence for actin (phalloidin). Scale bars represent 10 μm (for all images). (F) Percentage of cells with positive PLA reactions located within membrane protrusions. (G) Quantitation of PLA fluorescent intensity within membrane protrusions. Bar graphs represent the mean ± SEM. ****p <0.0001. These results are representative of three independent experiments.

Article Snippet: MAL2 (NM_052886) Human Tagged ORF Clone , Origene , Cat#RC203862.

Techniques: Imaging, Staining, Control, Knockdown, Labeling, Immunofluorescence, Membrane, Quantitation Assay

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Co-immunofluorescence staining for Ezrin (top) or HER2 (bottom) with phalloidin in PH-PLCδ-GFP-expressing control SKBR3 cells. Scale bars represent 10 μm. (B) Immunofluorescence staining for Ezrin (top) or HER2 (bottom) with phalloidin in PH-PLCδ-GFP-expressing MAL2KD_SKBR3 cells. (C) Immunofluorescence staining for Ezrin (top) or HER2 (bottom) with phalloidin in PH-PLCδ-GFP-expressing SKBR3 cells treated with MβCD. (D) Immunofluorescence staining for Ezrin with phalloidin in PH-PLCδ-GFP-expressing SKBR3 cells treated with wortmannin (0, 5, and 10 μM). (E) Immunofluorescence staining for HER2 with phalloidin in PH-PLCδ-GFP-expressing SKBR3 cells treated with wortmannin (0, 5, and 10 μM). (F) PLA results for HER2 and Ezrin in control and wortmannin-treated SKBR3 cells. Scale bars represent 10 μm. (G) Western blot analysis of AKT and phospho-AKT in control and MAL2 knockdown SKBR3 cells (left) and in control and MβCD-treated SKBR3 cells (right). (H–J) SIM imaging showing HER2, pAKT, and phalloidin immunofluorescence in control (H), MAL2KD (I)-treated, and MβCD-treated (J) SKBR3 cells. Scale bars represent 10 μm. (K) Immunofluorescence staining for FOXO1 in control, MAL2KD-treated, and MβCD-treated SKBR3 cells. (L) XTT cell viability assay in control, MAL2KD-treated, and MβCD-treated SKBR3 and BT474 cells. Bar graphs represent the mean ± SEM. ****p <0.0001. These results are representative of three independent experiments.

Article Snippet: MAL2 (NM_052886) Human Tagged ORF Clone , Origene , Cat#RC203862.

Techniques: Immunofluorescence, Staining, Expressing, Control, Western Blot, Knockdown, Imaging, Viability Assay

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: (A) Immunofluorescence staining for cholera toxin B (lipid rafts) in control and trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (B) Immunofluorescence staining for HER2 and MAL2 in control and trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (C) PLA for HER2 and MAL2 in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Scale bars represent 10 μm. (D–F) Quantitative results from immunoprecipitation coupled with data-independent acquisition mass spectrometry (DIA-MS) in control and trastuzumab-resistant SKBR3 cells. (D) The DIA-MS Intensity (log 2 ) of HER2 and MAL2 proteins from control and trastuzumab-resistant SKBR3 cells. (E) The DIA-MS Intensity (log 2 ) for all the peptide precursor signals of HER2 in control and resistant cells. (F) The DIA-MS peak groups visualized for quantifying HER2 (VLGSGAFGTVYK) and MAL2 (VTLPAGPDILR). Peaks above and below the middle line denote the MS2 and MS1 ion traces in DIA-MS. (G) MAL2, Ezrin, and NHERF1 mRNA expression in control and trastuzumab-resistant SKBR3 cells as assessed by quantitative RT-PCR (n = 3). (H) PLA for HER2 with Ezrin (left), NHERF1 (middle), and PMCA2 (right) in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Boxed portions are amplified at right with co-registration of PLA signal and immunofluorescence for actin (phalloidin). (I) Quantitation of PLA experiment for HER2 in combination with MAL2, Ezrin, NHERF1, or PMCA2 represented as the fluorescent intensity of amplified PLA signals associated with membrane protrusions. (J) Coimmunoprecipitation for HER2 and HSP90 in control and trastuzumab-resistant SKBR3 cells. (K) PLA for HER2 and HSP90 in control and trastuzumab-resistant SKBR3 cells also stained for phalloidin. Scale bars represent 10 μm. (L) XTT cell viability assay in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 and BT474 cells. (M) Immunofluorescence staining for FOXO1 in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 cells. (N) Immunofluorescence staining for HER2 and pAKT in control, MAL2KD-treated, and MβCD-treated trastuzumab-resistant SKBR3 cells. Scale bars represent 10 μm. (O) Diagram representing the structure of MAL2- and lipid raft-enriched membrane protrusions containing multi-protein HER2 signaling complexes. These results are representative of three independent experiments.

Article Snippet: MAL2 (NM_052886) Human Tagged ORF Clone , Origene , Cat#RC203862.

Techniques: Immunofluorescence, Staining, Control, Immunoprecipitation, Data-independent acquisition, Mass Spectrometry, Expressing, Quantitative RT-PCR, Amplification, Quantitation Assay, Membrane, Viability Assay

Journal: Cell reports

Article Title: MAL2 mediates the formation of stable HER2 signaling complexes within lipid raft-rich membrane protrusions in breast cancer cells

doi: 10.1016/j.celrep.2021.110160

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: MAL2 (NM_052886) Human Tagged ORF Clone , Origene , Cat#RC203862.

Techniques: Recombinant, Real-time Polymerase Chain Reaction, RNA Sequencing, Sequencing, Microarray, Control, Software, Imaging, Light Microscopy